Promoter Test: FENDRR_FC

RNA Sig promoters All promoters Autobinding Parameters

Autobinding

# DBD RNA DNA Score Motif Orientation Sequence
0 1502-1565 1503-1525 1503-1525 20 Y P
5'- CTCTTCTCTCTCCTCTCTTCTC -3'
3'- GAGAAGAGAGAGGAGAGAAGAG -5'
    ||||||||||**||||||||||
3'- CTCTTCTCTCCTCTCTCTTCTC -5'
1 1502-1565 1505-1525 1510-1530 16 Y P
5'- CTCTCCTCTCTTCTCCCTCC -3'
3'- GAGAGGAGAGAAGAGGGAGG -5'
    ||||*|||||*||||*||*|
3'- CTCTTCTCTCCTCTCTCTTC -5'
2 1502-1565 1505-1525 1505-1525 16 Y P
5'- CTTCTCTCTCCTCTCTTCTC -3'
3'- GAAGAGAGAGGAGAGAAGAG -5'
    ||**||||||||||||**||
3'- CTCTTCTCTCCTCTCTCTTC -5'
3 1502-1565 1507-1528 1507-1528 17 Y P
5'- TCTCTCTCCTCTCTTCTCCCT -3'
3'- AGAGAGAGGAGAGAAGAGGGA -5'
    ||*||||*|||||*||||*||
3'- TCCCTCTTCTCTCCTCTCTCT -5'
4 1502-1565 1508-1529 1508-1529 17 Y P
5'- CTCTCTCCTCTCTTCTCCCTC -3'
3'- GAGAGAGGAGAGAAGAGGGAG -5'
    |||*|||*|||||*|||*|||
3'- CTCCCTCTTCTCTCCTCTCTC -5'
5 1502-1565 1510-1530 1505-1525 16 Y P
5'- CTTCTCTCTCCTCTCTTCTC -3'
3'- GAAGAGAGAGGAGAGAAGAG -5'
    |*||*||||*|||||*||||
3'- CCTCCCTCTTCTCTCCTCTC -5'
6 1502-1565 1510-1535 1525-1550 20 Y P
5'- CCTCCCCTCCATCCTCTTCCTTCTC -3'
3'- GGAGGGGAGGtAGGAGAAGGAAGAG -5'
    ||||||||||*||*|||**|*||||
3'- CCTCCCCTCCCTCTTCTCTCCTCTC -5'
7 1502-1565 1518-1542 1518-1542 20 Y P
5'- TCTTCTCCCTCCCCTCCATCCTCT -3'
3'- AGAAGAGGGAGGGGAGGtAGGAGA -5'
    |||*||*||||||||||*||*|||
3'- TCTCCTaCCTCCCCTCCCTCTTCT -5'
8 1502-1565 1525-1550 1510-1535 20 Y P
5'- CTCTCCTCTCTTCTCCCTCCCCTCC -3'
3'- GAGAGGAGAGAAGAGGGAGGGGAGG -5'
    ||||*|**|||*||*||||||||||
3'- CTCTTCCTTCTCCTaCCTCCCCTCC -5'
9 1502-1565 1526-1552 1536-1562 21 Y P
5'- TCCTCTTCCTTCTCCTCCTCCTCTTC -3'
3'- AGGAGAAGGAAGAGGAGGAGGAGAAG -5'
    ||||||||||||||||*|**|*|*||
3'- TCCTCTTCCTTCTCCTaCCTCCCCTC -5'
10 1502-1565 1529-1554 1534-1559 20 Y P
5'- CATCCTCTTCCTTCTCCTCCTCCTC -3'
3'- GtAGGAGAAGGAAGAGGAGGAGGAG -5'
    |*||||||||||||||||*|**|*|
3'- CCTCCTCTTCCTTCTCCTaCCTCCC -5'
11 1502-1565 1534-1559 1529-1554 20 Y P
5'- CCCTCCATCCTCTTCCTTCTCCTCC -3'
3'- GGGAGGtAGGAGAAGGAAGAGGAGG -5'
    |*|**|*||||||||||||||||*|
3'- CTCCTCCTCCTCTTCCTTCTCCTaC -5'
12 1502-1565 1536-1558 1536-1558 18 Y P
5'- TCCTCTTCCTTCTCCTCCTCCT -3'
3'- AGGAGAAGGAAGAGGAGGAGGA -5'
    |||||*||||**||||*|||||
3'- TCCTCCTCCTCTTCCTTCTCCT -5'
13 1502-1565 1536-1562 1526-1552 21 Y P
5'- CTCCCCTCCATCCTCTTCCTTCTCCT -3'
3'- GAGGGGAGGtAGGAGAAGGAAGAGGA -5'
    ||*|*|**|*||||||||||||||||
3'- CTTCTCCTCCTCCTCTTCCTTCTCCT -5'
14 1502-1565 1538-1558 1542-1562 16 Y P
5'- TCCTTCTCCTCCTCCTCTTC -3'
3'- AGGAAGAGGAGGAGGAGAAG -5'
    ||||*||||||*||||**||
3'- TCCTCCTCCTCTTCCTTCTC -5'
15 1502-1565 1538-1559 1538-1559 17 Y P
5'- CTCTTCCTTCTCCTCCTCCTC -3'
3'- GAGAAGGAAGAGGAGGAGGAG -5'
    |||*||||*|||*||||*|||
3'- CTCCTCCTCCTCTTCCTTCTC -5'
16 1502-1565 1541-1565 1541-1565 22 Y P
5'- TTCCTTCTCCTCCTCCTCTTCTTT -3'
3'- AAGGAAGAGGAGGAGGAGAAGAAA -5'
    ||*||||||||||||||||||*||
3'- TTTCTTCTCCTCCTCCTCTTCCTT -5'
17 1502-1565 1542-1562 1538-1558 16 Y P
5'- CTCTTCCTTCTCCTCCTCCT -3'
3'- GAGAAGGAAGAGGAGGAGGA -5'
    ||**||||*||||||*||||
3'- CTTCTCCTCCTCCTCTTCCT -5'



For more details please visit the RGT Website